Бесплатный автореферат и диссертация по биологии на тему
Рекомбинантные цитокины и цитокин-связывающие белки
ВАК РФ 03.01.03, Молекулярная биология

Автореферат диссертации по теме "Рекомбинантные цитокины и цитокин-связывающие белки"

На правах рукописи

ГИЛЕВА Ирина Павловна

РЕКОМБИНАНТНЫЕ ЦИТОКИНЫ И ЦИТОКИН-СВЯЗЫВАЮЩИЕ

03.01.03 - молекулярная биология

АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук

2 С 0К7 2011

Кольцове - 2011 1

4857393

Работа выполнена в Федеральном бюджетном учреждении науки «Государственный научный центр вирусологии и биотехнологии «Вектор»

Научный консультант: доктор биологических наук, профессор

Щелкунов Сергей Николаевич

Официальные оппоненты:

доктор биологических наук, профессор

Загребельный Станислав Николаевич

доктор биологических наук, профессор

Кратасюк Валентина Александровна

доктор биологических наук, профессор

Меркулова Татьяна Ивановна

Ведущая организация: ФГУП «Государственный научно-исследовательский институт особо чистых биопрепаратов», г. Санкт-Петербург.

Защита состоится «11» ноября 2011 года в 9-00 часов на заседании диссертационного совета Д 208.020.01 при ФБУН ГНЦ ВБ «Вектор» по адресу: 630559, р.п. Кольцово, Новосибирского района, Новосибирской области, тел.: (8-383)336-74-28.

С диссертацией можно ознакомиться в библиотеке ФБУН ГНЦ ВБ «Вектор».

Автореферат разослан¿-7* V 2011 г.

Ученый секретарь диссертационного совета

доктор биологических наук, профессор

Г.П. Трошкова

Актуальность проблемы. Гормоны и цитокины обеспечивают согласованность действия иммунной, эндокринной и нервной систем человека в нормальных условиях и в ответ на патологические воздействия. Недостаток гормонов и цитокинов является причиной многих заболеваний человека (например, диабет при недостатке инсулина или нарушение гемопоэза при недостатке гемопоэтических факторов), коррекция которых возможна соответствующими препаратами экзогенного происхождения. Антивирусная, иммуномодулирующая и антипролиферативная активность цитокинов -интерферонов, фактора некроза опухолей (TNF), факторов кроветворения - делает перспективными их использование в качестве лекарственных средств. Выделение биологически активных веществ (БАВ) белковой природы из природных источников (донорского материала или тканей животных) малоэффективно из-за низких концентраций целевых продуктов или невозможно из-за иммунологической несовместимости. С другой стороны, гиперпродукция цитокинов лежит в основе патогенеза многих тяжелых заболеваний человека (в случае гиперпродукции TNF - ревматоидного артрита, менингита, септического шока, кахексии и др.).

Фундаментальные достижения молекулярной биологии, молекулярной генетики и энзимологии легли в основу возникновения в 70-х гг. прошлого века генетической инженерии или технологии создания рекомбинантных молекул. Суть этой технологии состоит в соединении in vitro фрагментов ДНК из различных источников и последующем введении «искусственной» ДНК в живую клетку, где она способна реплицироваться, а кодируемая ею информация экспрессироваться. Наиболее наглядным примером успеха такой методологии является создание новых эффективных лекарственных

средств на основе БАВ белковой природы - рекомбинантных гормонов и цитокинов.

К моменту начала работ по теме диссертации было показано, что экспрессия в клетках Escherichia coli генов цитокинов - интерферона а-2 (Nagata et al., 1980; Goeddel D.V. et. al., 1981) или GM-CSF (Burgess A.W. et. al., 1987) позволяет выделить из бактериальных клеток биологически активные рекомбинантные белки. Сотрудниками ГНЦ ВБ «Вектор» (р.п. Кольцово, Новосибирская область) и Института биоорганической химии им. М.М. Шемякина (г. Москва) методом прямого химического синтеза был получен и клонирован в бактериальной плазмиде (pLelFlac) синтетический ген //«а-2 человека (Колосов М.Н. и др., 1984). Необходимым продолжением этих работ является разработка стратегии создания высокопродуктивных штаммов Е. coli, обеспечивающих синтез таких важнейших для медицины БАВ, какими являются интерферон и GM-CSF.

В работах ряда исследователей (Щелкунов С.Н., 1995; Alcami А., 2003; Lukas A., McFadden G., 2004) высказаны предположения о возможности использования вирусных иммуномодуляторных белков для антицитокиновой терапии. Получение таких белков в биологически активной форме возможно в ряде случаев только в эукариотических клетках. Удобной системой для решения этой задачи является бакуловирусная система экспрессии.

Настоящая диссертационная работа посвящена конструированию штаммов-продуцентов интерферона а-2Ь и GM-CSF человека на основе бактерии Е. coli, а также рекомбинантных бакуловирусов, содержащих в своем геноме гены ортопоксвирусных TNF-антагонистов, и изучению свойств рекомбинантных белков, выделенных из бактериальных клеток и инфицированных клеток насекомых.

Цели и задачи исследования. Целью настоящего исследования является получение бактериальных штаммов-продуцентов рекомбинантных цитокинов - интерферона а-2Ь человека (ЫРЫа-2Ь), гранулоцитарно-макрофагального колониестимулирующего фактора человека (ЬСМ-СЭР) и эукариотических продуцентов ТЫР-связывающих белков вирусов натуральной оспы, оспы коров и оспы обезьян (УАЯУ-СгшВ, СРХУ-СгтВ, МРХУ-СгтВ), а также изучение физико-химических и биологических свойств этих рекомбинантных белков.

Для выполнения поставленной цели необходимо было решить следующие задачи:

-сконструировать рекомбинантные плазмиды, обеспечивающие высокий уровень экспрессии целевых генов в бактериальных клетках Е. соИ\

-изолировать из вирусных геномов гены ТЫР-связывающих белков вирусов натуральной оспы, оспы коров и оспы обезьян и получить рекомбинантные бакуловирусы, экспрессирующие гены вирусных ТЫР-связывающих белков в клетках насекомых;

-выделить из клеток штаммов-продуцентов и изучить физико-химические и биологические свойства полученных рекомбинантных белков (ЫРЫсх-2Ь, ЬСМ-СБР, УАЯУ-СгтВ, СРХУ-СгтВ и МРХУ-СгтВ);

-оценить терапевтический потенциал рекомбинантных белков ЬОМ-СБР и УАЯУ-СгтВ.

Научная новизна и практическая значимость результатов исследования. Впервые получены рекомбинантные бакуловирусы ВТК167 и ВТЯг96, детерминирующие синтез ТЫР-связывающих белков вирусов натуральной оспы и оспы обезьян (белков УАЯУ- и МРХУ-СппВ) в клетках насекомых линии Б/21, и впервые проведено

сравнительное изучение свойств белков VARV-CrmB, CPXV-CrmB и MPXV-CrmB in vitro. Впервые оценен TNF-нейтрализующий потенциал белка VARV-CrmB относительно некоторых TNF-антагонистов (клеточных TNF-рецепторов, поликлональных антител, TNF-нейтрализующего моноклонального антитела МАК 195, коммерческого препарата Ремикейд) на клетках мышиных фибробластов линии L929. Впервые показана TNF-нейтрализующая активность белка VARV-CrmB in vivo: увеличение количества выживших животных в экспериментальной модели эндотоксического шока и снижение MuTNF-индуцированной подвижности дендритных клеток кожи мышей линии Balb/c. Впервые показана нейтрализация белком VARV-CrmB эффектов MuTNF на модели костномозгового гемопоэза мышей Balb/c.

Сконструированы оригинальные рекомбинантные ДНК, обеспечивающие эффективный синтез в клетках E.coli продуктов экспрессии синтетических генов ifna-2b и gm-csf человека. Получен и депонирован во Всесоюзной коллекции промышленных микроорганизмов высокоэффективный штамм E.coii SG20050!pIF16 (В-5809) - продуцент рекомбинантного интерферона а-2Ь человека с выходом целевого продукта 3-4 хЮ7 МЕ/мл/109 кл. На основе этого штамма в ГНЦ ВБ «Вектор» разработана технология получения субстанции интерферона а-2Ь и его лекарственных форм. Получен и депонирован во Всесоюзной коллекции промышленных микроорганизмов штамм E.coli SG20050/p280GM (В-6613) - первый отечественный продуцент рекомбинантного GM-CSF человека, обеспечивающий выход целевого продукта в количестве 20-50 мг/л клеточной суспензии. Показано, что продукт экспрессии синтетического гена gm-csf в клетках E.coli видоспецифически стимулирует гранулоцитарно-макрофагальную дифференцировку гемопоэтических стволовых клеток и дендритных клеток. Получен штамм-продуцент и

препарат рекомбинантного TNF мыши (MuTNI-), что позволило использовать этот рекомбинантный белок в экспериментальных моделях при изучении терапевтического потенциала поксвирусных TNF-антагонистов.

Апробация работы. Материалы исследований по теме диссертации были представлены на российских и международных конференциях: Международный симпозиум «Регуляция трансляции», Рига (1989); Ш-я Всесоюзная конференция «Макромолекулы и клетки», Москва, Россия (1989); 2nd International conference "AIDS, Cancer and Human Retroviruses", St. Petersburg, Russia (1992); XI Poxvirus and Iridivirus Meeting, Toledo, Spain (1996); 2nd Russian Principal Investigator Conference, Holland (2001); Международная школа-конференция «Цитокины. Воспаление. Иммунитет», Санкт-Петербург, Россия (2002); 1st International Congress "BIOTECHNOLOGY - state of the art&prospects of development", Moscow, Russia (2002); Workshops "Review of Cooperative Biodefense Research Projects", Serpukhov, Russia (2002), St. Petersburg, Russia (2003); International conference "Chemical and biological problems of proteomics", Novosibirsk, Russia (2004); CBR annual review conference, St. Petersburg, Russia (2004); 12th International Congress of Immunology, Montreal, Canada, (2004); XVth International Poxviral and Iridoviral Symposia, Oxford, UK

(2004); Всероссийский научный симпозиум с международным участием «Цитокины. Стволовая клетка. Иммунитет», Новосибирск, Россия,

(2005); 30th FEBS Congress - 9th IUBMB Conference, Budapest, Hungary

(2006); Научно-практическая конференция «Сепсис: проблемы диагностики, терапии и профилактики», Харкш, УкраУни (2006); 17th International Poxvirus and Iridovirus Conference, Grainau, Germany (2008); XIV International congress of virology, Istanbul, Turkey (2008); Всеросийская научно-практическая конференция «Современные представления об иммунокоррекции», Пенза, Россия (2008); 18-я

Международная конференция «СПИД, рак и общественное здоровье», Санкт-Петербург, Россия (2009); Всероссийская научная конференция «Молекулярно-генетические основы функционирования цитокиновой сети в норме и при патологии», Новосибирск, Россия (2010).

Структура и объем диссертации. Диссертационная работа состоит из разделов введение, обзор литературы, материалы и методы исследования, результаты и обсуждение, заключение, выводы, список работ, опубликованных по теме диссертации, и библиографический список. Работа изложена на 312 страницах машинописного текста и включает 126 рисунков и 50 таблиц. Библиографический список содержит 643 источника.

Положения, выносимые на защиту:

1. Экспрессия генов в составе искусственных полицистронных оперонов с сопряженной трансляцией позволила создать бактериальные суперпродуценты рекомбинантных белков:

-интерферона а-2Ь человека с продуктивностью около 60% от суммарного клеточного белка;

-гранулоцитарно-макрофагального колониестимулирующего фактора человека с продуктивностью 15% от суммарного клеточного белка;

-фактора некроза опухолей мыши с продуктивностью 15-20% от суммарного клеточного белка.

2. Гены сгтВ вирусов натуральной оспы, оспы коров и оспы обезьян в составе генома рекомбинантных бакуловирусов детерминируют в клетках насекомых синтез белков, ингибирующих цитотоксическое действие TNF на клетках мышиных фибробластов дозозависимым образом.

3. Видоспецифические отличия в аминокислотных последовательностях белков VARV-CrmB, CPXV-CrmB и MPXV-CrmB

обуславливают различия их физико-химических и биологических свойств.

4. Белок VARV-CrmB обладает TNF-нейтрализующей активностью in vivo.

Работа выполнялась в ФБУН ГНЦ ВБ Вектор в рамках научных тем организации, по гранту Международного научно-технического центра #1685 «Разработка нового терапевтического препарата на основе ортопоксвирусного белка, связывающего фактор некроза опухолей человека», по грантам РФФИ 06-04-48074а и 10-04-00387а, в рамках Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России», госконтракт № 100430/--3052/266.

Конструирование рекомбинантных плазмид для экспрессии природных и синтетических генов в клетках Е. coli выполнено автором лично и в соавторстве с В.В. Кравченко, Т.С. Бондарь (НИКТИ БАВ, г. Бердск) и В.Н. Добрыниным, С.А. Филипповым, В.Г. Коробко (ГУН Институт биоорганической химии им. М.М. Шемякина и Ю.А. Овчинникова, г. Москва). Физико-химический анализ рекомбинантных белков hIFNct-2b и hGM-CSF выполнен автором лично и в соавторстве с З.А. Акименко, С.И. Ястребовым, В.И. Офицеровым (ЗАО «Вектор-Бест», г. Новосибирск). Изучение свойств штаммов-продуцентов Kcoli SG20050/pVFl6 и E.coli SG20050/p280GM проведено в соавторстве с И.А. Андреевой (ФБУН ГНЦ ВБ «Вектор») и Н.В. Наумовой (ЗАО «Вектор-Медика», р.п. Кольцово). Выделение рекомбинантных белков hIFNa-2b, hGM-CSF и MuTNF проведено в соавторстве с JI.P. Лебедевым, В.П. Романовым, Н.М. Пустошиловой (ФБУН ГНЦ ВБ «ВЕКТОР», р.п. Кольцово), А.Н. Закабуниным и Ю.Н.Козловой (ГУН ИХБФМ СО РАН, г. Новосибирск). Изучение биологических свойств рекомбинантного hGM-CSF проведено в соавторстве с С.К. Халдояниди, И.А. Орловской, Л.Б. Топорковой,

Л.В. Сахно, C.B. Сенниковым (ГУН НИИКИ СО РАМН, г. Новосибирск). Изучение СгшВ-белков ортопоксвирусов выполнено автором под общим руководством С.Н. Щелкунова. Конструирование рекомбинантных бакуловирусов BTRi67, BTRz96 и BTRgr90 проведено И.А. Рязанкиным, З.А. Максютовым, A.B. Тотмениным при участии автора. Компьютерный анализ аминокислотных последовательностей CrmB-белков проведен

A.B. Тотмениным и Д.В. Антонецом (ФБУН ГНЦ ВБ «ВЕКТОР», р.п. Кольцово). Выделение CrmB-белков проведено JI.P. Лебедевым (ФБУН ГНЦ ВБ «ВЕКТОР», р.п. Кольцово). Изучение физико-химических и иммунологических свойств СгшВ-белков проведено автором лично и в соавторстве с И.А. Рязанкиным, Н.М. Пустошиловой и Г.Н.Афиногеновой (ФБУН ГНЦ ВБ «ВЕКТОР», р.п. Кольцово). Изучение TNF-нейтрализующих эффектов CrmB-белков на клетках линии L929 и на модели ЛПС-индуцированного септического шока проведено автором лично, Т.С. Непомнящих под руководством автора и совместно с Г.В. Кочневой и A.A. Гражданцевой (ФБУН ГНЦ ВБ «ВЕКТОР», р.п. Кольцово). Изучение TNF-нейтрализующих эффектов белка VARV-CrmB в экспериментальных моделях костномозгового колониеобразования и ингибирования миграции клеток Лангерганса выполнено совместно с Л.Б. Топорковой, И.А. Орловской, Е.А. Вязовой (ГУН НИИКИ СО РАМН, г. Новосибирск). Автор также приносит благодарность настоящим и бывшим сотрудникам ФБУН ГНЦ ВБ «ВЕКТОР», внесшим свой вклад в проведение настоящего исследования - В.А. Лихошваю, В.В. Шамину, О.И. Серпинскому, Е.И. Рябчиковой, Е.М. Малковой, И.В. Виноградову, В.А. Агеенко и сотрудникам отдела Геномных исследований и разработки методов ДНК-диагностики поксвирусов. Особую благодарность автор выражает к.х.н.

B.В. Кравченко - инициатору изучения механизмов экспрессии генов в составе полицистронных оперонов и Е.А. Каргиновой за радость

совместной работы, д.б.н., профессору С.К. Василенко, отношение которого к жизни и науке являются примером.

По теме диссертации опубликовано 20 печатных работ (16 статей в научных журналах и сборниках научных трудов). Часть результатов защищена патентами (4 Патента РФ). Патент РФ № 2241754 включен в список 100 лучших патентов России за 1997-2007 гг.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

1. Конструирование рекомбинантных плазмид для экспрессии в клетках Е.соИ природных и синтетических генов в составе искусственных полицистронных оперонов

Взаимосвязанная трансляция генов бактериальных оперонов

позволяет предположить целесообразность использования этого принципа при конструировании экспрессионных плазмид. В работах (Кравченко В.В. и др., 1987, 1988) показано, что наиболее эффективная экспрессия полусинтетического гена 1ас2, находящегося в составе искусственного полицистронного оперона, наблюдается, когда его последовательность ЭЭ перекрывается или находится в непосредственной близости с терминирующим кодоном предшествующего гена В-белка фага М13. Высокий уровень экспрессии дистального гена оперона достигается за счет эффективной инициации трансляции, которая становится возможной благодаря разрушению вторичной структуры мРНК, происходящему в процессе трансляции проксимального гена. Рекомбинантные плазмиды рО8101+ и р1)3102+ (БШеЬег О., Ви]агс1 Н., 1982), физические карты которых представлены на рис. 1, использовали в качестве исходных векторных молекул.

Клонированием РэИ/ЕсоИ-фрагмента плазмиды р8К-381 (Серпинский и др., 1982), содержащего начало гена Ыа, промотор Руш и ген белка оболочки (В-белка) фага М13тр7 без 4-х С-концевых кодонов, и синтетического ЕсоШ/ВатН1-адаптера в плазмиде рО8,01+ получена

плазмида рОЗрУ1, физическая карта которой представлена на рис. 2А.

Эта плазмида представляет искусственный полицистронный оперон, в котором область стыка генов В-белка и сй/г организована таким образом, что ЗБ-последовательность дистального гена оперона перекрывается с терминирующим кодоном проксимального, как это изображено на рис. ЗА.

ь-г.аитама}

Рис. 1 Физическая карта плазмид pDSto1+ и pDSroJ+. Ыа, dhfr, cat - гены р-лактамазы, дигидрофолатредуктазы и хлорамфениколацетилтрансферазы, соответственно; orí - область начала репликации; tO - терминатор транскрипции фага А. Указано положение сайтов узнавания эндонуклеаз рестрикции Xhol, EcoRI, BamHI, HindIH, Ncol, Xbal и Pstl.

№ Hi."3

I"oton.. ■

Рис. 2 Физические карты плазмид pDSpVl (А) и pIF6/8 (Б). Указаны гены Ыа, dhfr, cat и ifna-2; терминатор транскрипции t0 фага X, полилинкер (pi), а также положение сайтов узнавания эндонуклеаз рестрикции EcoRI и BamHI. Подчеркнуты снизу терминирующие кодоны, сверху - перекрывание последовательности SD и кодона терминации.

В качестве дистального гена в плазмиде pDSpVl выступает природный ген dhfr. Для определения эффективности экспрессии синтетического гена интерферона альфа-2Ь человека в составе

искусственного полицистронного оперона сконструированы

рекомбинантные плазмиды р1Р6/8, рЗвПРИ и р2801БМ. Источник гена г/яа-2 - рекомбинантная плазмида рЬеПЧас (Колосов М.Н. и др., 1984). Нуклеотидная последовательность искусственного гена г/иа-2 и кодируемая им аминокислотная последовательность представлены на рис. 4.

-------В-белок--------------------------->

SD^ .->—~dhfr

... .GAATTCACCTAACTGAAGTAAGGATCCGCATCATGGTT......

SD ,;„а3 4-— ifnal—SD„y,/r dhfr

TAACTGAAGTAAGGATCAATTCTATGTGT. ..TAG..35n...GGATCCGCATCATGGTT... 2 i 0

Рис. 3 Последовательность нукпеотидов в области стыка генов В белка и dhfr (А); В белка и ifna-2 (Б). Курсивом обозначены терминирующие кодоны гена белка В и инициирующие кодоны генов dhfr и ifna-2. Жирным шрифтом обозначены SD-последовательности генов; п - нуклеотидный остаток.

А. (Колосов М.Н. н др., 1984)

atgtgtgatctgccgcagactcactctctgggttctcgtcgtactctgatgctgctggctcagatgcgtcgta

tctctcttttctcttgcctgasagaccgtcatgacttcggtttcccgcaggaagagttcggtaaccagttcca

gaaagctgaaactatccctgttctgcatgaaatgatccagcaaatcttcaacctgttctctactaaagactct

tctgctgcttgggacgaaaccctgctggacaaattctacactgaactgtaccagcaactcaacgacctcgagg

cttgtgttattcagggcgttggtgttaccgaaactccgctgatgaaagaggatagcatcctggctgttcgcaa

gtatttccakgtatcactctttacctgaaggaaaagaagtatagcccgtgtgcttgggaagttgttcgtgct

gagatcatgcgttccttctccctgtctactaaccrgcaggaatctctgcgttctaaagaatag

>, frApe+1, 166 bases

mcdlpqthslgsrotlmllaqmrrislfsclkdrhdfgfpqeefgnqfqk aetipvlhemiqqifnlfstkdssaawdetlldkfytelyqqlndleacv iqgvgvtetplmkedsilavrkyfqritlylkekkyspcawewraeimr sfslstnlqeslrske* Б. GenBank: AY25S838.1

tgtgacctaccacaaacccacagcctgggtagcaggaggaccttgatgctcctggcgcagatgaggagaatct ctcttttctcctgcttgaaggacagacatgactttggatttccccaggaggagtttggcaaccagttccaaaa ggctgaaaccatccctgtcctccatgagatgatccagcagatcttcaacctcttcagcacaaaagactcatct gctgcttgggatgagaccctcctagacaaattctacactgaactctaccagcagctgaatgacctggaagcct gtgtgatacagggggtgggggtgacagagactcccctgatgaaggaggactccattctggctgtgaggaaata cttccaaagaatcactctctatctgaaagagaagaaatacagcccttgtgcctgggaggttgtcagagcagaa atcatgagatctttttctttgtcacaaacttgcaagaaagtttaagatctaaagagtaatga >frA.pe+l, 165 bases

cdlpqthslgsristlmhaqmrrislfsclkdrhdfgfpqeefgnqfqk aetipvlhemiqqifnlfstkdssaawdetlldkfytelyqqlndleacv iqgvgvtetplmkedsilavrkyfqr1tlylkekkyspcawewraeimr sfslstnlqeslrske*

Рис. 4 Нуклеотидные последовательности искусственного (А) и природного (В) генов фга-2Ъ и кодируемые ими аминокислотные последовательности IFNa-2b. Подчеркнуты нуклеотиды искусственного гена, отличающиеся от природного. Сайт узнавания эндонуклеазы рестрикции PstI выделен жирным курсивом. Жирным

шрифтом выделены аминокислотные остатки Игз, Ни позволяющие типироваггь синтетический ген как ¡/па-2Ь.

Физическая карта плазмиды р№6/8 и последовательность нуклеотидов в области стыка генов В-белка и ¡/па-2Ъ представлены на рис. 2Б и рис. ЗБ, соответственно. В этой плазмиде ген сНг/г уже не входит в полицистронный оперон.

При конструировании плазмиды р3811РН с помощью синтетического олигонуклеотидного адаптера, структура которого представлена на рис. 5, изменили структуру гена ¡/па-2Ъ, что не привело к изменению соответствующей аминокислотной последовательности. В результате реконструкции одна из замен Б-^А приводит к утрате сайта РвУ в гене интерферона, другая изменяет терминирующий кодон ТАС^ТАА. Также при встройке адаптера происходит утрата сайта узнавания ЕсоШ-934 плазмиды рОБ®2*, что позволяет заменой Рзи/ЕсоШ-фрагмента плазмиды р3811РК на соответствующий фрагмент, содержащий тандем промоторов и часть лидерного пептида триптофанового оперона Е.соП, получить плазмиду р2801РЫ.

ЕсоЫ ТБЙ -»(/я Ы* ЕсоЮ*

ссааттсоаса......астсасюатс. . атстстса... сстс(х4тстстссоттстаааомтмскзатта1г7п

-р!Г6/К--А-

Рис. 5 Отличия структуры гена ;/«а-2Ь в плазмвде рЗШШ от его структуры в плазмиде р1Р6/8.

2. Эффективность экспрессии генов е составе искусственных полицистронных оперонов

Полученными плазмидами рБЯрУ^ рШ6/8, р3811РЫ и р280№К

трансформировали клетки Е.соН Б020050 и индивидуальные АргТсг-трансформанты использовали для получения клеточных лизатов, которые анализировали с помощью электрофореза в 12% БОБ-ПААГ и методом радиоиммуноанализа (РИА). Результаты электрофоретического фракционирования суммарных лизатов клеток Е.соП 5620050/р08рУ1 и 5О2ОО50/р1Р6/8 представлены на рис. 6. Плазмиды р08рУ1 и р1Р6/8, по сравнению с контрольной плазмидой рЬе1Р1ас, детерминируют синтез

новых полипептидов, составляющих мажорные полосы на фоне остальных клеточных белков, которые по молекулярным массам соответствуют дигидрофолатредуктазе мыши (22 кДа) и альфа-2 интерферону человека (19 кДа), соответственно.

Рис. 6 Фракционирование лизатов клеток Е.соН Я72О05О/рО5рУ1 (2) и Е.соЧ 5С2Шв/рШб/8 (4) в 12% БОЗ-ПААГ. 1 - лизат клеток Е.соН 8020050/рЬе1Р1ас; 3 -химотрипсиноген (25 кДа) и миоглобин (17 кДа), соответственно.

Плазмида р!Р6/8 позволяет количественно оценить уровень экспрессии генов искусственного бицистронного оперона путем измерения количеств белков В и 1РЫа-2Ь, синтезирующихся в клетках Е.соН, несущих эти плазмиды. Результаты РИА представлены в табл. 1.

Таблица 1

Определение количеств белка В и лейкоцитарного интерферона а-2Ь человека в лизатах клеток Е.соН 5020050/рОЭрУ! и Е.соЧ 8020050/рШб/в.

Плазмида Белок В (пмоль/109 Интеферон а-2Ь

клеток) (пмоль/109 клеток)

р05рУ1 28 0

рЬеШас 0 1.5

р№6/8 32 1600

Можно видеть, что уровень экспрессии дистального гена (г/па-2Ь)

практически в 50 раз превышает уровень экспрессии проксимального

{VIII), т.е. наблюдается эффект усиления экспрессии целевого гена в

результате трансляционного сопряжения.

Экспрессионные свойства плазмид р1Б6/8, р3811РЫ и р2801РЫ

исследовали определением процентного содержания 1РЫа-2Ь в клетках

Е.соИ денситометрией. Результаты проведенных экспериментов представлены в табл. 2.

3. Экспрессия дуплицированного гена ¡/па-2Ь в составе полицистронных оперонов с различным транскрипционным контролем

Увеличение в клетке количества копий определенного гена вызывает повышение уровня его продукта. Представляет интерес исследование экспрессии повторяющихся генов, находящихся в составе полицистронного оперона. Для направленной дупликации генов </ла-2Ь РвИ-фрагмент плазмиды рЬеИас, содержащий начало гена Ыа, 5'-концевую часть гена ¡/па-2Ъ, РяИ/ЕсоМ-адаптер в виде комплементарных дезоксиолигонуклеотидов длиной 30 и 38 п.о. и Рэй/ЕсоИ-фрагмент плазмиды рВ8.02+ использовали для получения промежуточной плазмиды р951РЫ. Для получения тандема генов \fna-2b РвИ/ЕсоИ-фрагменты плазмид р951РЫ и р3811РЫ в присутствии адаптера лигировали с интерферон-содержащими РэН-фрагментами плазмид рЬе1Р>11ас и р1Рб/8, получая в результате плазмиды р95/21РЫ и р381/21РК, соответственно. Заменой РбИ/ЕсоМ фрагмента плазмиды р381/21ЕЫ на соответствующий РвН/ЕсоМ фрагмент плазмиды р08280, содержащий тандем промоторов триптофанового оперона Е.соН, получили плазмиду р280/21РЫ. На рис. 7 схематически изображена структурно-функциональная организация полицистронных оперонов под контролем промоторов Р^ (р95/21ГМ; ¡/пач/па), Руш (р381/2ШЫ; 1Х-ППч/пафа) и Р,ф (р280/21РЫ; Ы/па-1/па).

Клетки Е.соН 8020050 трансформировали плазмидами р1Р6/8, р381ЦЫ, р2801РЫ, р95/21РЫ, р381/21РЫ и р280/2ШЫ и определяли в суммарных лизатах клеток уровень синтеза 1РЫа-2Ь денситометрией. Относительный уровень синтеза интерферона представлен в табл. 2, а результаты фракционирования суммарных лизатов плазмидосодержащих клеток - на рис. 8.

p95/2IFN

-AGGA----1 In—A TG_ifna TAAGGA—8n—-ATG_ifna_TAA

P3S1/2IFN

—ix-------ATGA-----VII!-----TAAGGA—Sn—A TG_ifna TAAGGA—8n—

ATG_Jfna_TAA—

p280/21FN

—trpL —TAAGGA—in—ATG_ifna TAAGGA—Sn—ATG_ifna_TAA—

--щ>1 —ТАЛввА—8п—АТв_|/па____ТААСОА—69п—■АТС,_¡/па_ТАЛ—

Рис. 7 Структурно-функциональная организация сигналов инициации трансляции генов интерферона в составе полицистронных оперонов плазмид р95/21КЫ, р381/21РЫ, р280/21КЫ и р1Р16 (раздел 5). Инициирующие и терминирующие кодоны генов ¡/па-То выделены жирным курсивом, последовательности Т80 (ГЯЛСКЗА) -подчеркнуты. Цифрами обозначено расстояние в нуклеотидных остатках между соответствующими регуляторными сигналами.

Рис. 8 Фракционирование суммарных лизатов клеток E.coli SG20050\p95/2IFN(9, 10), E.coli Ä?20050\pIF6/8 (1, 2), E.coli SG20050/pmiVN (3, 4), E.coli SG20050\p381/2IFN (5-8), E.coli SG2005V\p2&0WN (11, 12) и E.coli SG20050\p280/2IFN (13, 14) в 12% SDS-ПААГ. Положение интерферона a-2b указано стрелкой.

Уровень синтеза интерферона, детерминируемый плазмидой p95/2IFN, гораздо ниже, чем у вариантов, содержащих одну копию гена -pIF6/8 и р381IFN, а варианты p381/2IFN и p280/2IFN значительно превышают возможность своих аналогов с одной копией гена. Полученные результаты свидетельствуют, что сигнал инициации

трансляции, расположенный между двумя генами //ла-2Ь, функционирует только в случае эффективной трансляции предыдущего цистрона.

Таблица 2

Относительные уровни синтеза интерферона в клетках Е.соИ 8020050, содержащих плазмиды рШб/в, р3811РЫ, р2801И\!, р381/21РЫ и р280/21РЫ

Плазмида Промотор Количество копий гена Содержание ШЧа-2Ь, % от суммарного клеточного белка*

р1Р6/8 Рут 1 11

РУШ 1 10

р2801ИЧ (Р.п,Ь 1 30

р95/21РТЧ Р|ае 2 <1

р381/21Р>1 Руш 2 32

р280/21ТО (Р,г„Ь 2 60

* культивирование в 5 ил среды 1_ и

4. Выделение продукта экспрессии искусственного гена ¡/па-2Ь из клеток Е.соИ и анализ его структуры

Внутриклеточную локализацию продукта экспрессии искусственного

гена ;/ла-2Ь определяли, разделяя после ультразвуковой дезинтеграции

растворимую и нерастворимую в физиологической буферной системе фракции

клеточных белков. Экстракцию 1РЫа-2Ь из «телец включения» проводили

7.5 М солянокислым гуанидином (рис. 9А). Методом ВЭЖХ на

широкопористом носителе «Полисил ОДС-ЗОО» гуанидинхлоридную фракцию

1РЫа-2Ь дочищали до практически гомогенного состояния (рис. 9Б, дорожка

II), и такой препарат использовали для структурных исследований.

Установлено, что аминокислотный состав исследуемого полипептида

соответствует теоретически ожидаемому, Ы-концевым остатком является

цистеин, а последовательность пяти Ы-концевых аминокислот С-0-£-Р-(2- -

соответствует структуре лейкоцитарного интерферона человека (рис. 4). >1-

концевые аминокислотные остатки пептидов, образующихся при гидролизе

исследуемого полипептида бромцианом (лейцин, аргинин, изолейцин, лизин и

цистеиновая кислота), соответствуют структуре 1РЫа-2Ь (рис. 4).

Исчерпывающий гидролиз полипептида карбоксипептидазами А и В, а также

карбоксипептидазой Р показал, что образующаяся смесь аминокислот также соответствует С-концевой структуре 1РЫа-2Ь. Удельная активность препарата (фракция II), определенная по подавлению цитопатического действия вируса энцефаломиокардита мышей на культуре клеток легкого эмбриона человека Л-68, составила 108 МЕ.

1 2 3 4 5 I II

Рис. 9 Выделение IFNa-2b. А. Элекгрофоретический анализ фракций выделения продукта экспрессии синтетического гена ifna.-2b в E.coli. 1 - суммарный лизат клеток E.coli ¿■G20050\p280/2IFN; 2 - супернатант после ультразвуковой дезинтеграции клеток; 3, 4 -осадок и супернатант после обработки буфером PBS с 6М мочевиной, соответственно; 5 -супернатант после обработки фракции 3 солянокислым гуанидином (7.5М) в буфере PBS.

Б. Хроматография IFNa-2b на широкопористом обращено-фазовом носителе «Полисил ОДС-300» (колонка 2.3x40 мм). Элюцию белков проводили градиентом смеси ацетонитрила, изопропанола и воды (3:1:1) в 50% муравьиной кислоте. Элекгрофоретический анализ белковых фракций, соответствующих пикам I и II, представлен на дорожках I и II.

Проведенный химический и биологический анализ структуры и свойств продукта экспрессии синтетического гена ¡/тах-2Ь свидетельствует о его соответствии природному аналогу, а высокий уровень синтеза целевого рекомбинантного белка в разработанной экспрессионной системе позволяет создать штамм-продуцент, пригодный для внедрения в производство.

5. Конструирование штамма Е.соП - продуцента рекомбинантного

интерферона человека

Плазмида pIFl 6, прототипом которой является плазмида p280/2IFN,

содержит тандем генов i/na-2b под транскрипционным контролем тандема промоторов триптофанового оперона (Ptrpxs), но терминирующий кодон

первого гена ifna-2b и инициирующий кодон второго гена //«а-2Ь разнесены путем встройки синтетического цистрона оф9, как это представлено на рис. 7. На рис. 10А приведена физическая карта плазмиды pIF 16.

Плазмидой pIF16 трансформировали компетентные клетки Е.соЧ SG200500. Суммарные лизаты клеток трансформантов анализировали электрофорезом в 12% SDS-ПААГ (рис. 10Б). Содержание целевого белка в 1мл (109 кл/мл) культуры E.coli SG20050!pIF 16, определенное методом РИА, составляет 250-300 мкг, и не менее 2-5 107 МЕ, определенное по подавлению цитопатического действия вируса энцефаломиокардита мышей на культуру клеток легкого эмбриона человека Л-68. Штамм E.coli SG20050/pIFlö депонирован во Всероссийской коллекции промышленных микроорганизмов (ВКПМ), коллекционный номер В-5809.

На основе этого штамма-продуцента в ФБУН ГНЦ ВБ «Вектор» разработан способ получения субстанции интерферона альфа-2Ь (патент РФ №2123010, 1998), а ЗАО «Вектор-Медика» выпускает несколько видов лекарственных форм (Реаферон-ЕС, Реаферон-ЕС Липинт, Инфагель, Лайфферон).

Рис.10 А. Физическая карта плазмиды pIF16. Б. Фракционирование в 12% SDS-ПААГ суммарных лизатов клеток E.coli SG20050/pIF16, E.coli SG20O50/p28O/2IFN и E.coli SG20050. M - Prestained SDS-PAGE Standards (Low Range, BioRad, США).

M <r pII16 <-p2S(>/21«--EcafiSG200SO->

b-lactamae

."¿UAfit]

Универсальность предложенного способа конструирования экспрессионных плазмид проверялась путем экспрессии в составе искусственных бицистронных оперонов синтетического гена gm-csf человека и полусинтетического гена tuf мыши.

6. Экспрессия гена гранулоцитарно-макрофагального колониестимулирующего фактора человека в клетках E.coli

Синтетический ген gm-csf человека клонировали в полученной ранее плазмиде pDS280, получая плазмиду p280GM, в которой ген GM-CSF находится в составе бицистронного оперона под контролем тандема промоторов триптофанового оперона E.coli. Физическая карта плазмиды p280GM представлена на рис. 11 А.

Рекомбинантной ДНК p280GM трансформировали клетки E.coli SG20050 и АргТсг-трансформанты использовали для анализа уровня экспрессии синтетического гена. Результаты электрофоретического фракционирования суммарных лизатов клеток в 12% SDS-ПААГ представлены на рис. 11Б. По данным денситометрии плазмида p280GM детерминирует синтез целевого продукта, составляющий не менее 15% от суммарного белка клетки.

1 2 M 2 1

bfectamue

А. Б. В.

Рис. 11 А. Физическая карта плазмиды р280СМ. Б. Фракционирование в 12% ПААГ лизатов клеток E.coli SG20050/p280GM (1) и E.coli SG20050 (2). М - маркеры молекулярных масс белков: укороченный hLTa (144 ао., 16.2 кДа) и лизоцим (14.3 кДа). В. Вестерн-блот анализ с поликлональными антителами к GM-CSF человека (Sigma, США).

На рис. 11В приведены результаты вестерн-блот анализа с поликлональными антителами к ОМ-С8Р человека. Единственный полипептид, реагирующий с антителами - полипептид с молекулярной массой около 16 кДа.

Штамм Е.соП 5С20050/р28(ЮМ депонирован во ВКПМ как штамм-продуцент ОМ-С8Р человека под коллекционным номером В-6613. Используя описанную процедуру выделения рекомбинантного ЬОМ-С8Р (Ве1е\у М. й а1., 1994) из бактериальных клеток, включающую получение "телец включения", солюбилизацию, ренатурацию и хроматографические процедуры (гельфильтрацию, адсорбционную и ионообменную хроматографии), получены образцы субстанции ОМ-СЭР человека (рис. 12). Выход рекомбинантного белка при таком способе выделения составляет около 2 мг из 2 г клеточной биомассы.

Рис. 12. Фракционирование в 12% SDS-ПААГ препаратов рекомбинантного GM-CSF человека в присутствии (+) и отсутствии (-) 2-меркаптоэтанола (2-МЕ). А. Выделение 2005 г. (10 мкг/дорожка); Б. Выделение 1996 г. (10, 5 и 1 мкг/дорожка).

Конформационную идентичность этих препаратов с рекомбинантными

h- и MuGM-CSF бактериального происхождения (рис. 13А) подтвердили

путем измерения спектров кругового дихроизма (КД-спектров) на

спектрополяриметре JASCO J-600. Результаты анализа представлены на рис.

Рис. 13 А. КД-спектры препаратов ЬОМ-СБР и МиОМ-СБИ (Wingfield Р. й а1„ 1988).

Б. КД-спектры препаратов ЬОМ-С5Р-1996 (1) и ЬОМ-С5Р-2005 (2). Ось абсцисс - длина волны [X, нм]. Ось ординат - молекулярная эллиптичность [0, град см2 моль"1].

Полученные препараты сравнивали по их способности генерировать популяции дендритных клеток (ДК) прилипающими мононуклеарными клетками венозной крови человека. Результаты представлены в табл. 3.

Таблица 3

Фенотипические маркеры ДК, генерированных в присутствии различных препаратов

ОМ-СЗБ (40 нг/мл)

Доноры Препараты ГМ-КСФ % ( П14 клеток % CD 83* клеток

1 hGM-CSF-1996 48 13

hGM-CSF-2005 41 58

hGM-CSF (Sigma) 35 18

2 hGM-CSF-1996 31 22

hGM-CSF -2005 20 4

hGM-CSF (Sigma) 43 30

3 hGM-CSF-1996 29 52

hGM-CSF-2005 40 46

hGM-CSF (Sigma) 28 46

Можно видеть, что клеточные ответы на препараты рекомбинантного ЬЮМ-СЭР сопоставимы. По данным работы ЬерНпа О.У. е1 а1. (1997), 80-90% прилипаюших к пластику моноцитов имеют фенотип СВ14+С083". Добавление к моноцитам как коммерческого, так и экспериментальных

препаратов рекомбинантного hGM-CSF, приводит к истощению фракции €D14+-KjteroK и увеличению фракции С083+-клеток, т.е. к появлению зрелых дендритных клеток.

Для изучения биологической активности рекомбинантного GM-CSF человека in vitro использовали мононуклеарные клетки костного мозга (КМ) больных с различными патологиями (цирроз, СКВ, ОЛЛ, лимфома). Как показывают данные, представленные в табл. 4, при добавлении рекомбинантного hGM-CSF (10 нг/мл) в метилцеллюлозную среду MethoCult GF Н4230 наблюдается образование гранулоцитарно-макрофагальных колоний мононуклеарными клетками (МНК) больных, а их количество соответствует числу колоний, формирующихся в полной среде, содержащей коммерческий rhGM-CSF. В метилцеллюлозной среде MethoCult GF Н4230 без добавления rhGM-CSF МНК колонии не формируют.

Таблица 4

Влияние rhGM-CSF на колониеобразующую способность мононуклеарных клеток КМ пациентов с различными патологиями.

Патология MethoCult H 4434 (полная среда) MethoCult H 4230 Юнг rhGM-CSF, MethoCult H 4230 (без цитокинов)

СКВ 11,0 ±1.2 10,8 ± 1,5 0

Цирроз 30,0 ±1,9 22,5 ±1,0 0

ОЛЛ 12,0 ±2,3 17,3 ±2,0 0

Лимфома 2,5 ±0,3 2,5 ±0,6 0

Клетки КМ мышей (CBAxC57Bl/6)Fl 0 0 0

MethoCultGF М3434 Гполная среда) MethoCult М3231 Юнг rhGM-CSF MethoCult М3231

Клетки КМ мышей (CBAxC57Bl/6)Fl 18± 3,2 0 0

Известно (Rasco J., Gough N. et al., 1994), что в отличие от G-CSF, GM-CSF обладает видовой биологической специфичностью и, в частности, hGM-CSF не оказывает пролиферативного эффекта на мышиные гемопоэтические клетки-предшественники. При добавлении исследуемого препарата hGM-CSF

(10 нг/мл) к метилцеллюлозной культуре клеток КМ мышей, не содержащей цитокины, не происходит образования каких-либо колоний, тогда как культивирование этих клеток в метилцеллюлозной среде, содержащей полный набор цитокинов, приводит к формированию стандартного набора колоний (табл. 4).

Результаты проведенного исследования свидетельствуют, что продукт экспрессии в Exoli синтетического гена gm-csf человека обладает функциональными свойствами GM-CSF человека и может использоваться для разработки технологии получения субстанции rhGM-CSF и отечественных лекарственных форм для нужд практического здравоохранения.

6. Экспрессия полусинтетического гена Inf мыши

В работах (Nedospasov С.А. et al., 1986; Semon D. et al., 1987) описана нуклеотидная последовательность локуса 17-ой хромосомы мыши, содержащая гены TNF и LT-a. Основная часть смысловых кодонов гена tnf мыши локализована в четвертом экзоне, а наличие в этой нуклеотидной последовательности сайтов узнавания эндонуклеаз рестрикции Xhol и EcoRI позволяют изолировать часть гена tnf мыши. Плазмида pGEM, содержащая фрагмент геномной ДНК мыши, соответствующий четвертому экзону, была любезно предоставлена С.А. Недоспасовым. XhoI/EcoRI(639 п.о.)-фрагмент этой плазмиды и синтетический ВатН1/ХЬо1-адаптер, с помощью которого восстанавливается N-концевая часть зрелого TNF мыши, клонировали в полученной ранее плазмиде pDSpVl. Физическая карта плазмиды pMuTNF и структура адаптера представлены на рис. 14. В плазмиде pMuTNF полусинтетический ген tnf мыши находится в составе бицистронного оперона.

Рекомбинантными ДНК pMuTNF и pTNF311 (Коробко В.Г. и др., Патент РФ 1445193), в которой ген tnf человека находится под контролем конститутивных промоторов AI и А2 фага Т7, трансформировали клетки E.coli SG20050 и АргТсг-трансформанты использовали для анализа уровня экспрессии генов tnf человека и мыши.

Л'(»1 (1526) I

gatcaattctatgctgcgtagctcttcicagaactcgagcgacaagccggttgctcatgttgttgctaaccatcaggttgaagaacagc

ttaagatacgacgcaicgagaagagtcltgagctcgctgttcggccaacgagtacaacaacgatiggtagtccaacttcttgtcgagca 5' 1

Рис. 14 Физическая карта плазмиды pMuTNF и структура синтетического адаптера, использованного для конструирования полусинтетического гена Mutnf.

Результаты электрофоретического фракционирования в 12% SDS-ПААГ представлены на рис. 15А. По сравнению с контролем (дорожка 1) плазмиды pMuTNF (дорожка 2) и pTNF311 (дорожка 3) детерминируют синтез в клетках К coli SG20050 полипептидов с молекулярной массой около 16 кДа. По данным денситометрии уровень экспрессии полусинтетического гена Mu tnf составляет около 15% от суммарного белка клеток. Выделение рекомбинантного MuTNF проводили методом, разработанным для выделения рекомбинантного TNF человека (hTNF) из бактериальных клеток (Лебедев Л.Р. и др., 1995). Электрофореграммы индивидуальных белков представлены на рис. 15А. Рекомбинантный RTNF выделен по той же технологии из клеток E.coli SG20050, несущих плазмиду pRTNF, полученную В.В. Кравченко клонированием полусинтетического reHaRf«/ в плазмиде pDSpVl. Результаты вестерн-блот анализа с поликлональными антителами к hTNF, приведенные на 1 рис. 15Б, свидетельствуют, что MuTNF и RTNF практически не реагируют с этими антителами. Удельную активность рекомбинантных препаратов TNF определяли в цитотоксическом тесте на клетках мышиных фибробластов линии L929 относительно отраслевого стандарта ОСО 42-28-212-93, оттитрованного по препарату TNF 1740/58 фирмы Celltech (США). Она

составила 6х107, ЗхЮ7 и 1.5х107 ME для hTNF, MuTNF и RTNF, соответственно.

Рис. 15 Фракционирование в 12% SDS-ПААГ (А) и вестерн-блот анализ с поликлональными антителами к hTNF (Б) суммарных лизатов клеток E.coli SG20050 (1), E.coli SG20050, содержащих плазмиды pMuTNF (2) и pTNF311 (3), индивидуальных белков MuTNF (Mu), hTNF (h), RTNF (R) и hIFNa-2b (IFN). M - Prestained SDS-PAGE Standards (Low Range, BioRad, США).

Из совокупности представленных данных следует, что предлагаемый способ экспрессии генов в составе полицистроных оперонов, имеющих сопряженную систему трансляции, в сочетании с эффективным транскрипционным контролем, позволяет достичь высокого уровня экспрессии целевых продуктов и открывает возможность создания высокоэффективных конститутивных штаммов-продуцентов биологически активных веществ.

7. Экспрессия генов поксвирусных TNF-связывающих белков в клетках насекомых и изучение свойств рекомбинантных белков

Вирусы рода Orthopoxvirus семейства Poxviridae являются опасными патогенами человека и животных, которые в процессе эволюции освоили различные молекулярные механизмы преодоления ранних неспецифических защитных реакций организма хозяина на вирусную инфекцию. Представители этого рода вирусов детерминируют синтез секретируемых белков-вироцепторов, которые функционируют как связывающие цитокины белки, блокируя, таким образом, их активность. Патогенность ортопоксвирусов для

человека уменьшается в ряду VARV->MPXV->CPXV и может быть связана с функциональной активностью вироцепторов.

Ключевую роль в координировании антивирусного ответа, как и функционирования иммунной системы в целом, играет TNF. Нарушение контролируемой продукции TNF играет критическую роль в этиологии развития ряда заболеваний человека, таких как ревматоидный артрит, менингит, септический шок, кахексия. Способность вирусных белков взаимодействовать с иммунной системой человека открывает перспективу их использования для разработки лекарственных иммунокоррекционных средств. Необходимым предварительным этапом таких разработок является сравнительное изучение физико-химических и биологических свойств вирусных TNF-связывющих (СппВ)-белков.

7.1 Сравнительный анализ аминокислотных последовательностей TNF-связывающих белков вирусов натуральной оспы, оспы коров и оспы обезьян

В геноме вируса оспы коров (CPXV) выявлены 5 рамок трансляции, в

той или иной степени гомологичных клеточному TNF-рецептору 11-го типа (TNFRII), и для продуктов генов crmB, crmC, crmD и сгтЕ показана TNF-связывающая активность (Saraiva М., Aleami А., 2001). У вируса натуральной оспы (VARV) изологом гена I4R CPXV, кодирующего белок CrmB, является ген G2R, а у вируса оспы обезьян (MPXV) - ген J2R (Shchelkunov S.N. et al., 2002).

Для 10-ти штаммов VARV, 22-х штаммов MPXV и 14-ти штаммов CPXV проведен анализ степени внутри- и межвидовой гомологии CrmB белков и его результаты, представленные в табл. 5, свидетельствуют о высокой степени гомологии этих белков.

Сравнительный компьютерный анализ аминокислотных последовательностей CrmB-белков, проведенный для штаммов VARVIND-1967 (Х67117) и VARV_GAR-1966 (Х70841), MPXV_ZAI-1996-1-16 (AF380138) и MPXV_CON-2003-358 (DQ011154) относительно штамма

CPXV_GRI-1990 (X94355), результаты которого представлены на рис.16, выявляет несколько видоспецифичных аминокислотных замен.

Таблица 5

Гомология CrmB белков VARY, CPXV и MPXV

Вид ортопоксвирусов CPXV VARV MPXV

MPXV 82 - 92% 84-96% 99 - 100%

VARV 82-91% 98-100%

CPXV 85 - 100%

H4R-GRI J2R-ZAI J2R-CNG G2R-IND G2R-GAR

H4R-GRI J2R-ZAI J2R-CNG G2R-IND G2R-GAR

H4R-GRI J2R-ZAI J2R-CNG G2R-IND G2R-GAR

H4R-GRI J2R-ZAI J2R-CNG G2R-IND G2R-GAR

H4R-GRI J2R-ZAI J2R-CNG G2R-IND G2R-GAR

H4R-GRI J2R-ZAI J2R-CNG G2R-IND G2R-GAR

mksvlysyilflsciiingsdiaphapsngkckdneynrhnlcclscppgtyasrlcdsk

M|sVLYSYILFLSCIIING8:DLAPHAPSNGKCKDNEy^^LCCLSCPPGTYASRLCDSK K^SVLYSYILPLSCIIINGaDIAPHAPSNGKCKDNEY^^NLCCLSCPPGTYASRLCDSK MKSVLY|YILFLSCIIINGRI^PfflPSNGKCKDgEY|RHNLCCLSCPPGTYASRLCDSK MKSVLY|YILFLSCIIINGRD§ipEpiNGKCKD0EYBRHNLCCLSCPPGTYASRLCDSK

tntntqctpcgsgtftsrnnhlpaclscngrcdsnqvetrsc

tnt—qctpcgs|tftshnnhl^aclscngrcdsnqvetrsc TNT—QCrPCGS§TFTSHNNHL|ACLSCHGRCDSNQVETRSC TNT—QCTPCGSGTFTSRNNHLPACLSCNGRCBSNQVETRSC TNT—QCTPCGSGTFTSRNNHLPACLSCNGRCgsNQVETRSC

NTTHN NTTHN NTTHN NTTHN NTTHN

*ICECAPGYYCLL UCECSPGYYCLL UCECSPGYYCLL UCECSPGYYCLL UCECSPGYYCLL

kgssgckacvsqtkcgigygvsghtstgdwcspcglgtyshtvssadkcepvpsntfny kgssgc^C|s|tkcgigygvsg|tstgdvicspcg|gtyshtvsstdkcepvfsntfny kgssgc^^ps§tkcgigygvsg^tstgdvicspcgpgtyshtvsstdkcep\^sn3^eily kgssgckacvsqtkcgigygvsghtssgdvicspcg|gtyshtvssadkcepvp|ntfn|

KGSSGCKACVSQTKCGIGYGVSGHTsBGDVICSPCGgGTYSYTVSSTDKCEPVP§UI£iiI

IDVEINLYPV IDVEINLYPV IDVEINLYPV IDVEI0LYPV IDVEI§L'

^NDTSi ^NDTSi J NDTSi JNDTSi

.YPVM.DT.Si

:trttttglsesistseltitmnhkdcdpvfrdgyfsvlnkvatsg

:trttttglsesistseltitmnhkdcdpvfr|eyfsvln|vatsg :trttttglsesistseltitmnhkdcdpvfr^eyfsvln|vatsg

:TRTTTTGLSESlgfTSELTITMNHBDCg|PVFREEYFSVLNKVATSG ¡TRTTTTGLSESlgTSELTITMNHgDCggPVFREEYFSVLNKVATSG

FFTGENRYi II FFTGENRY$1 FFTGENRY( FFTGENRYibl FFTGENRYi ¡1

¡NISI iNTSl UNTS1 ¡NISI ¡NISI

rCTLNFEIKCNNKDSSSKQLTKTKNDDGIMPHSETVTLVGDCLSSVD :TLNFEIKCNNKDSSSKQLTKTKKbT-IMFfeSETVTLVGDCLSSVD .JTLNFEIKCNNKDSSSKQLTKTKtjjT-IME HSETVTLVGDCLSSVD •CTLNFBIKCNNKgSS§KQLTKgKNDDG^igHSETVTLAGDCLSSVD GTLNFEIKCNNK|sS§KQLTl®KNDDG$MgHSETVTLAGDCLSSVD

IYILYSNTNTQDYETDTISYHVGNVLDVDSHMPGSCDIHKLITNSKPTRFL* 351

IYILYSNTNTQDYETDTISYHglGNVLDVffSHMP|fsCDIHKLITNSQNPTHL* 348

IYILYSNTNTQDYETDTISYH§GNVLDV§SHMP||SCDIHKLITNSQNPTHL* 348

IYILYSNTNgQDYETDTISYBvGNVLDgDSHMPGSCNIHKPITNSKPTRFL* 349

IYILYSNTN§QDYETDTISY§VGNVLD§DSHMPGSCDIHKLITNSKPTRFL* 34 9

Рис. 16 Анализ аминокислотных последовательностей СгшВ-белков.

Сравнение аминокислотных последовательностей проводили с помощью программы СЬиБТАЬ \¥(1.82); для анализа сигнальных последовательностей использовали программу 8(§па1Р; поиск потенциальных сайтов гликозилирования проводили с помощью программы Не(ЫС1ус. Серым и черным цветами обозначены видопецифичные (относительно белка СРХУ-СгшВ) аминокислотные замены белков МРХУ-СгтВ и УАКУ-СгтВ, соответственно. Потенциальные сайты Ы-гликозшшрования заключены в рамку. Вертикальными линиями обозначены потенциальные сайты отщепления сигнальных пептидов.

Такая видоспецифичность может являться причиной различий конформации и характера гликозилирования белковых молекул, что, в свою

очередь, будет обуславливать различия физико-химических, иммунологических и биологических свойств ортопоксвирусных СгшВ-белков.

Выделение природных белков СгшВ в количествах, необходимых для изучения их физико-химических и биологических свойств, невозможно как по чисто техническим причинам, так и в силу сложности организации работ с особо опасными вирусами натуральной оспы и оспы обезьян. Результатом экспрессии генов СгшВ-белков в клетках E.coli оказалась продукция нерастворимых, биологически неактивных продуктов (Ryazankina O.I. et al., 1998). Для получения рекомбинантных белков, свойства которых максимально соответствовали бы природным аналогам, использовали эукариотическую бакуловирусную систему экспрессии Bac-to-Bac (Luckow V.A. et al., 1993).

7.2 Конструирование рекомбинантных бакуловирусов, продуцирующих СгтВ-белки

Методом ПЦР, используя в качестве матрицы Xhol-P фрагменты из созданных ранее клонотек фрагментов ДНК VARV (Щелкунов С.Н. и др., 1992), MPXV (Shchelkunov S.N. et al., 1998) и CPXV (Shchelkunov S.N. et al., 2001), а также ген-специфические праймеры, получали фрагменты размером 1081, 1080 и 1088 п.о., содержащие кодирующие последовательности генов G2R, J2R и I4R соответствующих вирусов. Полученные ПЦР-фрагменты клонировали в плазмиде интеграции pFastBac, физическая карта плазмиды интеграции pFastBac-G2R представлена на рис. 17А. В клетках E.coli DHlOBac в результате сайт-специфической транспозиции плазмид интеграции в бакмиду bMON14272 получили рекомбинантные бакмиды bMON14272-G2R, bMON14272-J2R и bMON14272-I4R, После трансфекции бакмидами bMON 14272-G2R, bMON14272-J2R и bMON14272-I4R клеток насекомых линии SOI отобрали рекомбинантные бакуловирусы BTRÏ67, BTRz96 и BTRgr90. Полученные рекомбинантные бакуловирусы детерминируют в клетках SÎ21 синтез и секрецию в культуральную среду субстанций, ингибирующих цитотоксический эффект TNF на клетках L929 дозозависимым образом, как это показано на рис. 17Б.

Рис. 17 А. Физическая карта плазмиды интеграции pFastBac-G2R. Б. Ингибирование цитопатического действия hTNF ростовой средой клеток SÍ21, инфицированных рекомбинантными бакуловирусами. Кривые выживаемости клеток L929 в присутствии ростовой среды клеток SÍ21, инфицированных векторным бакуловирусом (1), 50 ЕА hTNF и ростовой среды клеток Sf21, инфицированных векторным бакуловирусом (2), 50 ЕА hTNF и разведения (начиная 1:10 и последующие двукратные) ростовых сред клеток S£21, инфицированных рекомбинантными бакуловирусами BTRÍ67, BTRgr90 и BTRz96 (3-5, соответственно). Каждая точка представляет среднее из трех измерений.

Полученные рекомбинантные бакуловирусы депонированы в музее ФБУН ГНЦ ВБ «Вектор» и имеют коллекционные номера VB-02, VB-03 и VB-01, соответственно.

Выделение рекомбинантных TNF-связывающих белков проводили методом хроматографии на аффинном носителе, представляющим иммобилизованный на акриламид-агарозном матриксе (ультрагель АсА 34) hTNF. Выход рекомбинантных вирусных белков составил 4.0-5.5 мг/л, 0.9-1.2 мг/л и 0.2-0.35 мг/л для VARV-CrmB, CPXV-CrmB и MPXV-CrmB, соответственно.

7.3 Изучение физико-химических свойств рекомбинантных ортопоксвирусных TNF-связывющих белков

Электрофоретический анализ полученных препаратов рекомбинантных

белков VARV-CrmB, MPXV-CrmB и CPXV-CrmB в редуцирующих и

нередуцирующих условиях, которые достигаются присутствием или

отсутствием 2-МЕ в пробах, представлен на рис. 18А. Молекулярная масса

афинноочищенных препаратов (в присутствии в пробах 2-МЕ), составляет 4547 кДа (дорожки 1, 3, 5). Несовпадение наблюдаемых молекулярных масс с теоретически ожидаемыми, исходя из аминокислотного состава СгшВ-белков (например, для УАКУ-СгтВ молекулярная масса должна составлять 38.2 кДа), позволяет предположить модификацию данных полипептидов гликозилированием. При отсутствии 2-МЕ в пробах, молекулярная масса УАЯУ-СгшВ (дорожка 6) соответствует димеру (90 кДа), а препараты МРХУ-СгтВ и СРХУ-СгтВ (дорожки 2 и 4) - мономерам (45-47 кДа).

<-СРХУ-»<-МРХУ-»<- \'АК\'Ч>

2-МЕ + - + - + -

Рис. 18 А. фракционирование CrmB-белков в 12%-ном SDS-ПААГ. Нагрузка - 1мкг на дорожку. Стрелками обозначено положение белков-маркеров молекулярного веса 7В, 45.7 и 32.5 кДа (Kaleidoscope standarts, BioRad, США). + или - обозначает присутствие или отсутствие 2-МЕ в пробах.

Б и В. Гликозилирование белка VARV-CrmB. Рекомбинантный белок VARV-CrmB (дорожка 3) и белки-маркеры oti-кислый гликопротеин, фетуин, овальбумин, БСА и лизоцим в двух повторах (дорожки 1, 2, 4-6, соответственно) фракционировали электрофорезом в 12% SDS-ПААГ. Одну половину геля окрашивали краской Coomassie brilliant blue R250 (Б), другую - реагентами набора GelCodeR Glycoprotein Staining Kit (В), (образцы 1 и 2 нанесены зеркально).

Дифференциальное окрашивание белка VARV-CrmB и гликозилированных в различной степени белков-стандартов, фракционированных в SDS-ПААГ (рис. 18Б, В), подтверждает факт его гликозилирования.

На рис. 19 приведены результаты фракционирования 8 мкг VARV-CrmB в 8% SDS-ПААГ и вестерн-блот анализ с двумя видами поликлональных

антител - AbGsT::VARv-CrmB и AbvARv-СтЛ- При окрашивании геля красителем Кумасси R250 выявляются высокомолекулярные, предположительно олигомерные формы VARV-CrmB, что подтверждается результатом вестерн-блот анализа. Выявление олигомерных форм рекомбинантного белка в препаратах афинноочищенного VARV-CrmB вызвало необходимость определить его конформацию в нативном состоянии, т.е. в каком виде он синтезируется в клетках насекомых.

Кумасси R250 вестерн-блот

<г 2 4- 1

Рис. 19 Фракционирование в 8% БОЭ-ПААГ рекомбинантного белка УА&У-СгтВ и вестерн-блот анализ с поликлональными антителами АЬуАй-У-сгтв (1) и АЬозт.-уану-споВ (2)-Белки-маркеры молекулярных масс (М): 116 кДа (р-галакгозидаза), 88 кДа (БСА) и 45 кДа (овальбумин). + или - означает присутствие или отсутствие 2-МЕ в буфере для нанесения образцов. Стрелками указаны мономерные, димерные и олигомерные формы белка УАЛУ-СгтВ.

Для этого осветленный лизат инфицированных клеток насекомых фракционировали на колонке с биогелем А-0.5т. Полученные фракции исследовали в тесте ингибирования цитотоксического действия ЬТЫР на клетки линии Ь929. Результаты этого эксперимента представлены на рис. 20. ТОТ-нейтрализующая активность, в основном, определяется во фракциях, соответствующих свободному объему колонки, и, следовательно, должна соответствовать олигомерным формам VARV-CrmB, молекулярная масса

которых превышает 500 кДа. Минорная Т№-нейтрализующая активность определяется во фракциях белков с молекулярными массами 270 кДа и 90 кДа, что может соответствовать гексамерным и димерным формам УАЯУ-СгшВ.

0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1

- 1 : ♦ ♦ :

-- 0 ' * 1 * д ♦

1 .' * ♦¿к о*

>—--м пп111111п1п|||||1н1нн1к11|||м11|||1|пп1п|ш+нн-

сч сч со со ^г

Номер фракции

Рис. 20 Гельфильтрация на биогеле А-0.5ш лизатов клеток насекомых линии 5121, инфицированных рекомбинантным бакуловирусом ВУ167.

Колонку калибровали с помощью маркеров молекулярных масс, выход которых обозначен стрелками: А, 2000 кДа (голубой декстран); В, 440 кДа (ферригин); С, 232 кДа (каталаза); О, 67 кДа (БСА); Е, 45 кДа (овальбумин). (-—) - концентрация белков, ОП28о (_) - ТОТ-нейтрализующая активность, ОП550.

Эффективность взаимодействия вирусных "ШР-связывающих белков с ЬТЫР изучали методом конкурентного твердофазного иммуноферментного анализа, с помощью которого оценили уровень связывания ЬШР с собственными поликлональными антителами (АЬьтда) в присутствии различных количеств очищенных препаратов вирусных белков. Результаты, представленные на рис. 21, свидетельствуют о том, что вирусные белки ингибируют этот процесс, эффективность которого (% ингибирования) уменьшается в порядке: УАЯУ-СгтВ > СРХУ-СгтВ > МРХУ-СгтВ.

J> ^f A? & <9

концентрации vTNF-BP, мкг/мл

13 VARV-CrmВ sCPXV-CrmB DVPX\/-CrmB

Рис, 21 Ингибирование вирусными TNF-связывающими белками взаимодействия поликлональных антител AbbTNF с hTNF.

7.4 Изучение биологических свойств ортопоксвирусных TNF-связывающих белков in vitro

Способность рекомбинантных СгшВ-белков предотвращать взаимодействие TNF или LT-a с рецепторами эукариотических клеток исследовали по их способности нейтрализовать цитопатическое действие hTNF, MuTNF, RTNF, а также человеческого лимфотоксина (hLT-a), используя клетки мышиных фибробластов линии L929 как мишени, а рекомбинантные белки VARV-, MPXV- и CPXV-CrmB как ингибиторы. В качестве отрицательного контроля использовали у-интерферон-связыващий белок вируса натуральной оспы, также синтезированный в клетках насекомых и выделенный с помощью аффинной хроматографии (Непомнящих Т.С. и др., 2005). Как демонстрируют результаты, представленные в табл. 6 и на рис. 22, белок VARV-CrmB практически с одинаковой эффективностью ингибирует цитопатическое действие человеческого, мышиного и кроличьего TNF и hLT-a. MPXV-CrmB обладает наименее выраженным ингибирующим действием. CPVX-CrmB с наибольшей эффективностью ингибирует цитопатическое действие мышиного TNF.

Таблица I

Концентрации белков СгтВ, обеспечивающие 50%-ное ингибирование цитокин-индуцированного лизиса клеток линии Ь929.

Цитокин VARV-CrmB CPXV-CrmB MPXV-CrmB

2 нг/мл (нг/мл) (нг/мл) (нг/мл)

hTNF 6.0 50.0 100.0

MuTNF 5.9 5.9 50.0

RTNF 7.0 50.0 400.0

hLT-a 7.7 43.0 300.0

□ ЬТ№ НМиТОТ в НЮТ вьт-а

Рис. 22 Эффективность действия рекомбинантных СгшБ-белков. Концентрация УАЛУ-СгшВ, обеспечивающая 50% защитный эффект от действия ИТОИ (бхЦП&о ) на культуре клеток Ь929 (УАаУ-СгтВ5о%), принята за 100%. Остальные значения рассчитаны по формуле: К-СгшВ5о%Л/АЯУ-СгтВ51)%х 100%, где Я-СгтВ - МРХУ- и СРХУ-СгтВ, соответственно.

Для того, чтобы оценить потенциал белка VARV-CrmB как возможного; TNF-антагониста, сравнили эффективность нейтрализации цитотоксического действия hTMF на клетки мышиных фибробластов L929 вирусного белка1 VARV-CrmB и ряда известных TNF-антагонистов (hTNFsRI, hTNFsRII, поликлональных антител к TNF, TNF-нейтральзующего МАК 195, препарата1

Remicade). Величины IC50, при которых наблюдается 50% ингибирование цитотоксического действия hTNF, приведены в табл. 7.

Таблица 7

Эффективность нейтрализации in vitro цитотоксического действия hTNF различными TNF-

ангагонистами (aTNF)

Препараты aTNF Отношение концентраций hTNF:aTNF при достижении 1С;,

VARV-CrmB 2 нг/мл : 4-8 нг/мл 1:2-4

шАЬ МАК 195 2 иг/ил : 12-15 нг/мл 1:6-7.5

AbtNF 2 нг/мл : 40-100 нг/мл 1:20-50

Renucade*1 2 нг/мл : 0.5-1 нг/мл * 1: 0.25-0.5

hTNFsRI 2 нг/мл: 0.2-0.3 мкг/мл 1:100-150

hTNFsRl R&D Systems" (США) 25 нг/лп: 30-60 нг/лп 1:120-240

bTNFsRII 2 нг/мл : 2-3.5 мкг/мл 1 : 1000-1750

hTNFsRll R&D Systems" (США) hTNFsRI/Fc Chimera R&D Systems" (США) 0.25 нг/мл : 0.2-0.6мкг/мл 0.25 нг/мл: 0.4-1 нг/мл 1:860-2400 1:1.6-4

h mFsRIl/Fc Chimera R&D Systems" (США) 0.25 нг/мл : 4-16 нг/мл 1:16-64

* Концентрация infliximab, входящего в препарат Remicade.

Курсивом обозначены данные, взятые из каталога фирмы R@D Systems" (США).

В табл. 7 указаны также значения 1С50 для растворимых клеточных и химерных, содержащих Fc-иммуноглобулиновый домен (Bathon J.M. et al., 2000), рецепторов (hTNFsRI, II или hTNFsRI, II/Fc Chimera, соответственно), взятые из каталога фирмы «R@D Systems» (США). Хорошее соответствие экспериментально определенных в настоящей работе значений 1С50 для TNFsRI и TNFsRII служит внутренним контролем и позволяет заключить, что эффективность ингибирования цитотоксического действия hTNF рекомбинантным белком VARV-CrmB in vitro соизмерима с активностью химерных рецепторов TNF и TNF-нейтрализующего моноклонального антитела mAb МАК195, но несколько уступает активности препарата Remicade®.

7.5 Ингибирование белком VARV-CrmB эффектов MuTNF на колониеобразующую активность клеток костного мозга мышей Balb/c

Использование этой экспериментальной модели обусловлено тем фактом, что хронические воспалительные процессы (в т.ч. ревматоидный артрит) часто сопровождаются формированием анемии, в основе патогенеза которой лежат TNF-опосредованные нарушения пролиферации и усиление апоптоза эритроидных предшественников (Papadaki Н. et al., 2002). Количество коммитированных предшественников в КМ мышей BALB/c оценивали в метилцеллюлозной культуре, обогащенной ростовыми факторами в отсутствии и присутствии MuTNF в концентрациях от 2 до 40 нг/мл, VARV-CrmB в концентрациях от 2 до 24 нг/мл, а также в комбинациях 2 нг/мл MuTNF и белка VARV-CrmB в концентрациях от 2 до 12 нг/мл. Количество колоний гемопоэтических предшественников (БОЕ-Э, КОЕ-Э, КОЕ-ГМ) оценивали на 14 день. Во всех используемых концентрациях MuTNF ингибировал рост эритроидных колоний (БОЕ-Э+КОЕ-Э), а в концентрациях 2 нг/мл и 10 нг/мл стимулировал рост гранулоцитарно-макрофагальных колоний (КОЕ-ГМ), как это представлено на рис. 23А. VARV-CrmB в отсутствии MuTNF не оказывал влияния на костномозговое колониеобразование (данные не приведены). Совместное воздействие MuTNF и VARV-CrmB приводило к

восстановлению МиТОТ-индуцированного снижения количества эритроидных колоний (БОЕ-Э+КОЕ-Э) и МиТЫР-индуцированного повышения численности КОЕ-ГМ, как это показано на рис. 23Б.

Рис. 23 А. Влияние MuTNF на колониеобразующую активность клеток КМ мышей BALB/c. 1: контроль, 2-5: 2, 10, 20 и 40 нг/мл TNF, соответственно. БОЕ-Э и КОЕ-Э - ранние и поздние предшественники эритроидных клеток; КОЕ-ГМ - предшественники колоний гранулоцитов и макрофагов. * Достоверное снижение относительно контроля (р < 0.05); ** Достоверное повышение относительно контроля (р < 0.05).

Б. Влияние VARV-CrmB на TNF-индуцированные изменения колониеобразующей активности клеток КМ мышей BALB/c. 1: контроль, 2: 2 нг/мл TNF, 3-5: 2 нг/мл Т№+2нг/мл, 6 нг/мл и 12 нг/мл VARV-CrmB, соответственно. # Достоверное снижение относительно контроля (р < 0.05); ## Достоверное повышение относительно контроля (р < 0.05); * Достоверное повышение относительно 2 нг/мл TNF (р < 0.05)

7.6 Изучение биологических свойств ортопоксвирусных TNF-связывающих белков in vivo

Эффекты белков CrmB в экспериментальной модели ЛПС-

индуцированного эндотоксического шока JTIIC(LPS)-

индуцированный эндотоксический шок (реакция Шварцмана) является

широко используемой экспериментальной моделью септического шока

(Lamping N. et al., 1999). При определении дозы ЛПС (L2880 E.coli серотипа

055:В5; Sigma, США), вызывающей гибель экспериментальных животных

(самцы SPF мышей линии Balb/c весом 15-20г), варьировали способ

приготовления раствора ЛПС, его сенсибилизирующие и разрешающие дозы.

Эксперименты проводили в соответствии с Протоколом, утвержденным

Биоэтическим комитетом ФБУН ГНЦ ВБ «Вектор». Окончательная схема

экспериментов выглядела следующим образом: экспериментальны животным внутрибрюшинно вводили сенсибилизирующую и через 16 ча разрешающую дозы ЛПС, равные 300 и 350 мкг/мышь, соответственно, таких условиях смертность животных контрольной группы составила 70-80% Препараты белков СгшВ вводили в дозах 0.2 и 2 мкг/мышь за 30 мин д введения разрешающей дозы ЛПС. Наблюдение за животными продолжалос 72 ч. Патоморфологическая картина изменений внутренних органо экспериментальных животных соответствовала описанной в литературе пр развитии экспериментального эндотоксического шока у мышей (Барштейн др., 1990). Динамику содержания TNF, IL-lß и IFNy в сыворотке кров экспериментальных животных при индукции эндотоксического шока изучал методом иммуноферментного анализа, используя коммерческие тест-системы Уровень IFNy и IL-lß после индукции шока во всех исследованных образца сывороток крови были ниже порога чувствительности используемых тест систем. Определение концентрации TNF в сыворотках крови животных в те же условиях выявило, что непосредственно после введения разрешающе дозы ЛПС происходит повышение содержания TNF с последующим ег снижением через 3,6 и 24 часа практически до фонового уровня. Установлено что максимально достигаемый уровень TNF составляет 500-600 пкг/мл. Н рис. 24 приведены результаты учета гибели животных в проведении экспериментах. Введение животным совместно с БСА рекомбинантных белко СгшВ в дозе 2 мг/мышь не вызывает гибели животных. Не удалое обнаружить какого-либо терапевтического действия белков CPXV- и MPXV СгшВ. Введение препаратов VARV-CrmB в дозах 0.2 или 2 мкг достоверн уменьшает смертность экспериментальных животных.

5й S 80 • я

PBS- СЖУ-СптЗ iuim HFKV-CfmS. 2u«riwuis ■ LfiS'BSA

■ i геМГРХУ-СчпЗ w 1 i«r¿UMa>i

0 24 48 71

- P6S+ VAftV-Címe. 2 мк/Лшши

------ LPS'P6S

-----U^-VARV-CnrB íluKtjubKjst)

----- LPS>VARy-Crine ( о г

Рис. 24 Выживаемость экспериментальных животных при ЛПС-индуцированном эндотоксическом шоке после введения рекомбинантного белка СРХУ-СгшВ и МРХУ-СгтВ (А) и УАЯУ-СгтВ (Б). Стандартное отклонение рассчитано с использованием независимого критерия Стьюдента для уровня значимости р<0.05.

Ингибирование белком VARV-CrmB индуцируемую MuTNF подвижность клеток Лангерганса Одна из популяций дендритных клеток кожи - эпидермальные резидентные клетки Лангерганса (КЛ) -образуют плотную сеть, локализованную в базальном и супрабазальном слоях эпидермиса, и составляют 3-5% от популяции эпидермальных клеток (MeradM. et al., 2008). Цитоплазматические отростки Ю1 внедряются между кератиноцитами, образуя непрерывную сеть, что позволяет им постоянно контролировать возможные нарушения гомеостаза внутри эпидермиса. При повреждениях кожи, вторжении патогенов, контакте с аллергенами происходит локальный выброс провоспалительных цитокинов TNF и IL-ip, которые индуцируют мобилизацию КЛ в лимфоидную ткань. Известна экспериментальная модель, позволяющая определять интенсивность миграции КЛ в зависимости от применяемого стимула (Вязовая Е.А. и др., 2007). В этой экспериментальной модели изучали способность белка VARV-CrmB ингибировать MuTNF-индуцируемую подвижность КЛ. На дорзальную поверхность ушей животных апплицировали PBS (группа I), MuTNF (250 нг;

группа II), VARV-CrmB (500 нг; группа III) и последовательно MuTNF и через 30 мин VARV-CrmB (250 нг + 500 нг, соответственно; группа IV). Результаты подсчета клеток, мигрировавших из кожного лоскута (через 2 часа после аппликации), представлены на рис. 25. Нанесение MuTNF на участок кожи мышей линии Balb/c вызывает миграцию KJI из кожного лоскута, под действием белка VARV-CrmB миграции клеток не происходит, а последовательное нанесение на поверхность кожи MuTNF и белка VARV-CrmB достоверно снижает MuTNF- индуцируемую миграцию клеток.

25 ----------

Рис. 25 Миграция клеток из кожного лоскута дорзальной части уха мышей Balb/c. По оси ординат: количество клеток х1000. По оси абцисс: экспериментальные группы животных' 1 - PBS; II - MuTNF (250 нг); III - VARV-CrmB (500 нг); IV - MuTNF+VARV-CrmB (250 нг+500 нг, соответственно).

Изучение свойств нового класса Т№-антагонистов - поксвирусных Т№-связывающих белков - открывает перспективу фундаментальных исследований, направленных на изучение взаимодействия вирусных иммуномодуляторных белков с иммунной системой теплокровных. Несомненный терапевтический потенциал белка VARV-CrmB позволяет рассматривать его как базовый элемент для разработки нового поколения иммунокорректирующих терапевтических средств.

1. Предложен способ эффективной экспрессии генов в составе искусственного полицистронного оперона, в котором последовательность SD дистального гена перекрывается с терминирующим кодоном проксимального.

2. Получены рекомбинантные плазмиды (pIF6/8, p381IFN, p381/2IFN, p280IFN, p280/2IFN, pIF16), обеспечивающие в клетках Exoli SG20050 конститутивный синтез интерферона ct-2b человека, составляющий 1060% от суммарного клеточного белка. Штамм-продуцент рекомбинантного интерферона а-2Ь человека E.coti SG20050/plFl6 депонирован во Всероссийской коллекции промышленных микроорганизмов (коллекционный номер В-5809).

3. Получены рекомбинантная плазмида p280GM, содержащая синтетический ген гранулоцитарно-макрофагального колониестимулирующего фактора человека, и штамм E.coli SG20050/280GM - продуцент соответствующего цитокина с уровнем синтеза целевого продукта около 15% от суммарного белка клетки. Штамм депонирован во Всероссийской коллекции промышленных микроорганизмов (коллекционный номер В-6613).

4. Показано, что продукт экспрессии синтетического гена гранулоцитарно-макрофагального колониестимулирующего фактора человека в клетках Exoli видоспецифически стимулирует дифференцировку гемопоэтических стволовых клеток.

5. Получены и депонированы в музее Культур клеток микроорганизмов ФБУН ГНЦ ВБ «Вектор» рекомбинантные бакуловирусы BTRi67, BTRz96 и BTRgr90, детерминирующие синтез растворимых TNF-связывающих белков вирусов натуральной оспы, оспы обезьян и оспы коров (коллекционные номера VB-01, VB-03 и VB-02).

6. Показано, что видоспецифические аминокислотные замены в TNF-

связывающих белках вирусов натуральной оспы, оспы коров и оспы

обезьян выражаются в различных физико-химических и биологически свойствах этих белков: -степень ингибирования связывания hTNF с собственным поликлональными антителами уменьшается в ряду VARV-CrmB СРХ CrmB->MPXV-CrmB;

-различается эффективность ингибирования цитотоксического действи человеческого, мышиного, кроличьего TNF и LT-a человека на клетк мышиных фибробластов линии L929;

-только белок VARV-CrmB оказывает выраженный лечебный эффект н проявления ЛПС-индуцированного эндотоксического шока у мыше линии Ва1Ь/с, достоверно увеличивая процент выживших животных.

7. Показано, что белок VARV-CrmB, синтезирующийся в клетка насекомых, обладает олигомерной структурой и гликозилирован.

8. Рекомбинантный белок VARV-CrmB нейтрализует in vitro: -цитототоксическое действие hTNF на культуре клеток мышины фибробластов линии L929 с эффективностью на 2-3 порядк превышающей аналогичные эффекты растворимых клеточных TNF рецепторов 1-го и 11-го типов и соизмеримой с активностью TNF нейтрализующего моноклонального антитела МАК 195;

-MuTNF -опосредованые эффекты в экспериментальной модел костномозгового колониеобразования мышей Ва1Ь/с, увеличив количество эритроидных и уменьшая количество гранулоцитарно макрофагальных колоний до базального уровня.

9. Рекомбинантный белок VARV-CrmB in vivo нейтрализует MuTNF индуцируемую миграцию клеток из кожного лоскута мышей лини Balb/c.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ Статьи в научных журналах:

1. Гилева И.П., Мизенко Г.А., Серпинский О.И., Аммосов А.Д., Кравченко В.В. Усиление экспрессии клонированных генов в результате использования системы искусственного полицистронного оперона // Доклады АН СССР. 1986. Т. 288. № 3. С. 734-737.

2. Кравченко В.В., Гилева И.П., Шамин В.В., Лихошвай В.А., Куличков В.А., Добрынин В.Н., Филиппов С.А., Чувпило С.А., КоробкоВ.Г. Конструирование и свойства искусственных полицистронов на основе укороченных генов триптофанового оперона E.coli и белка оболочки фага М13 // Биоорган, химия. 1987. Т. 13. № 9. С. 1176-1185.

3. Кравченко В.В., Гилева И.П., Шамин В.В., Лихошвай В.А., Куличков В.А., Добрынин В.Н., Филиппов С.А., Чувпило С.А., Коробко В.Г. Дупликация синтетического гена лейкоцитарного интерферона человека и его экспрессия в составе полицистронной мРНК с сопряженной системой трансляции // Биоорган, химия. 1987. Т. 13. № 9. С. 1186-1193.

4. Акименко З.А., Зыков С.А., Шапров В.В., Офицеров В.И., Гилева И.П., Кравченко В.В. Химически синтезированный ген обеспечивает в Е. coli синтез полипептида со свойствами лейкоцитарного интерферона человека альфа-2//Доклады АН СССР. 1991. Т. 319. С. 1248-1251.

5. Гилева И.П., Бондарь Т.С., Блинова H.H., Халдояниди С.К., Кравченко В.В., Ястребов С.И., Офицеров В.И., Коробко В.Г. Экспрессия синтетического гена гранулоцитарно-макрофагального колониестимулирующего фактора в Е. coli //Доклады АН СССР. 1994. Т. 336. С. 254-256.

6. Гилева И.П., Рязанкин И.А., Максютов З.А., Тотменин A.B., Агеенко В.А., Нестеров А.Е., Щелкунов С.Н. Сравнительное изучение

свойств ортопоксвирусных растворимых рецепторов фактора некроз опухолей //Доклады РАН. 2003. Т. 390. № 5. С. 1-5.

7. Гилева И.П., Рязанкин И.А., Непомнящих Т.С., Тотменин A.B. Максютов З.А., Лебедев JI.P., Афиногенова Г.Н., Пустошилова Н.М. Щелкунов С.Н. Экспрессия генов TNF-связывающих белко ортопоксвирусов в клетках насекомых и изучение свойст рекомбинантных белков // Молек. биол. 2005. Т. 39. С. 245-254.

8. Гилева И.П., Малкова Е.М., Непомнящих Т.С., Виноградов И.В. Лебедев Л.Р., Кочнева Г.В., Гражданцева A.A., Рябчикова Е.И. Щелкунов С.Н. Изучение действия TNF-связывающего белка вирус натуральной оспы на развитие ЛПС-индуцированного эндотоксическог шока // Цитокины и воспаление. 2006. Т. 5. С. 44-48.

9. Gileva I.P., Nepomnyashchikh Т.С., Antonez D.V., Lebedev L.R., Kochnev G.V., Grazhdantseva A.A., Shchelkunov S.N. Properties of the recombinan TNF-binding proteins from variola, monkeypox and cowpox viruses ar different//Biochimica et Biophysica Acta. 2006. V. 1764. P. 1710-1718.

Ю.Сахно Л.В., Леплина О.Ю., Тихонова M.A., Распай Ж.М., Гилева И.П. Никонов С.Д., Жданов O.A., Останин A.A., Черных Е.Р. Характеристик дендритных клеток, генерируемых в присутствии интерферона-а, больных туберкулезом легких // Проблемы туберкулеза и болезне" легких. 2007. № 3. С. 42-46. Н.Топоркова Л.Б., Орловская И.А., Сенников C.B., Сахно Л.В. Козлова Ю.Н., Лебедев Л.Р., Гилева И.П. Изучение in vitr биологических свойств рекомбинантного гранулоцитарно макрофагального колониестимулирующего фактора // Иммунология. 2009. №4. С. 203-205. 12.Гилева И.П., Непомнящих Т.С., Рязанкин И.А., Щелкунов С.Н. Рекомбинантный TNF-связывающий белок вируса натуральной оспы ка потенциальный TNF-антагонист нового поколения // Биохимия. 2009. Т. 74. С. 1664-1671.

И.Топоркова Л.Б., Петухова A.A., Гилева И.П., Орловская И.А. Рекомбинантный белок вируса натуральной оспы нейтрализует эффекты фактора некроза опухолей на модели костномозгового гемопоэза мышей Balb/c // Мед. Иммунология. 2010. Т. 12. № 4-5. С. 275-280.

14. Цырендоржиев Д.Д., Сенников C.B., Вязовая Е.А., Гилева И.П., Щелкунов С.Н., Рязанкин RA., Лебедев Л.Р., Топоркова Л.Б., Курилин В.В., Петухова A.A., Орловская И.А. Влияние рекомбинантного TNF-связывающего белка вируса натуральной оспы на миграционную и окислительно-восстановительную функции лейкоцитов крови мышей при эпикутанной аппликации фактора некроза опухолей // Бюллетень СО РАМН. 2011. Т. 31. № 3. С. 73-79.

Работы, опубликованные в сборниках научных трудов:

1. Гилева И.П., Кравченко В.В., Шамин В.В. Роль структуры матричных РНК в регуляции биосинтеза белка у прокариот. // Генетическая инженерия, молекулярная биология, селекция промышленных микроорганизмов: Обзорн. информ. М.: ВНИИСЭНТИ. 1990. Вып. I. С. 1-22.

2. Романов В.П., Андреева И.С., Гилева И.П., Порываев В.Д., Пучков а Л.И., Закабунин А.И. Разработка методов повышения стабильности продуцента и способа выделения рекомбинантного альфа-2-интерферона человека // Сборник науч. тр. сотрудников НИКТИ БАВ. Посвящается 25-летию института. Бердск. 1996. С. 55-63.

Патенты:

1. Гилева И.П., Бондарь Т.С., Коробко В.Г., Кравченко В.В., Сандахчиев Л.С. Рекомбинантная плазмидная ДНК p280GM, кодирующая полипептид со свойствами гранулоцитарно-макрофагального колониестимулирующего фактора человека, и штамм E.coli SG20050/p280GM - продуцент полипептида со свойствами

гранулоцитарно-макрофагального колониестимулирующего фактора человека. Патент РФ 2091488, опубликован 27.09.1997, бюлл. № 27.

2. Кравченко В.В., Гилева И.П. Сандахчиев JI.C., Петренко В.А., Коробко В.Г., Добрынин В.Н. Рекомбинантная плазмидная ДНК pIF16, кодирующая полипептид со свойствами интерферона альфа-2 человека, и штамм E.coli SG20050/pIF16 - продуцент полипептида со свойствами интерферона альфа-2 человека. Патент РФ № 2054041, опубликован 10.02.1996, бюлл. №4.

3. Пикалова М.И., Наумова Н.В., Доманова З.М., Хайбулина И.И., Гилева И.П., Колокольцов A.A. Способ промышленного получения рекомбинантного GM-CSF человека. Патент РФ 2144083, опубликован 10.01.2000, бюлл. № 1.

4. Гилева И.П., Щелкунов С.Н., Рязанкин И.А., Максютов З.А., Тотьменин A.B., Нестеров А.Е., Агеенко В.А. Рекомбинантная плазмидная ДНК pFastBac-G2R, содержащая фрагмент генома вируса натуральной оспы, кодирующий белок-аналог рецептора ФНО, и штамм бакуловируса BTRi67, продуцирующий растворимый рецептор ФНО вируса натуральной оспы. Патент РФ № 2241754, опубликован 10.12.2004, бюлл. №34.

ГИЛЕВА Ирина Павловна

РЕКОМБИНАНТНЫЕ ЦИТОКИНЫ И ЦИТОКИН-СВЯЗЫВАЮЩИЕ

Автореферат диссертации на соискание ученой степени доктора биологических наук

Формат 60x84/16 Тираж 100 экз.

Подписано в печать 19.08.2011

Усл. печ. л. 3 _Заказ № 87

Отпечатано на полиграфическом участке Института катализа СО РАН 630090, Новосибирск, пр-т Академика Лаврентьева, 5

Содержание диссертации, доктор биологических наук , Гилева, Ирина Павловна

Введение Диссертация по биологии, на тему "Рекомбинантные цитокины и цитокин-связывающие белки"

Заключение Диссертация по теме "Молекулярная биология", Гилева, Ирина Павловна

Библиография Диссертация по биологии, доктор биологических наук , Гилева, Ирина Павловна, Кольцово